Justinochsjoey Justinochsjoey

24-11-2020
History

contestada

Which statement best describes Alexander the Great. A. He built a massive empire military Qonquest B. he created neutral route with the Persian empireC. He forced the Persian empire except the Greek religion. D. He read Greece to victory in the Greco Persian wars

Respuesta :

warriorhorse360 warriorhorse360

24-11-2020

Answer:

A.

Explanation:

He Built the largest empire ever seen. I used quizlet/google and parcially my brain from prior knowledge (please forgive me if im wrong)

Answer Link

Otras preguntas

2. How do mountains form? How the mount 3. List the evidence we have for proving Pangea existed? Diagrams: Fill in the data chart below. Write a description of

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

Why is subjective important in news reporting?

In August 1841, a Boston citizen bailed out a "common drunkard" by permission of the Boston Police Court and helped the man with a drinking problem before retur

x + y +z=5. - 2x - 3y + 2z = 8 3x - y - 2z=3

In addition to a subject's sensory capacity, signal detection theory takes into account a the tendency for the subject's performance to worsen over time. b the

Top-down processing occurs when individuals detect and combine specific features of a stimulus into a more complex form in order to gain understanding of the wh

You are provided the following information: Salaries for assembly workers $32,000 Cost of materials $1,400 Lubricants for machines $680 Accountant’s salary

Parents decide to implement the following plan to reduce swearing in their two adolescent daughters. Each time a girl swears, she is fined a penny. Results from

You measure the power delivered by a battery to be 5.83 W when it is connected in series with two equal resistors. How much power will the same battery deliver