21-08-2020
Mathematics

contestada

b/11-6b/11=10/11 solve for b asap

Respuesta :

MIRAGEE MIRAGEE

21-08-2020

I hope this helps you

b-6b/11=10/11

-5b=10 (divide -5 both of sides)

b=-2

Answer Link

Otras preguntas

Describe the fluid theory of intelligence; then explain your views on the theory

How many times dose 63 go into 359

what do you think accounts for algerias score it has received in recent years on government stability and the absence of violence

10(x+3)=9 mmmmmmmmmmmmmmmmm

Pedro tapes a 3 5/6 piece of paper to a 2 3/4 inch of piece with no overlap. how long is the piece of paper he made?

A storage unit is in the shape of a cube with 8 feet edge lengths what is the surface area of the storage unit

How do I do this? tell me the answer and how you got it.....I have to graph this later

how to find the average range of cells A1:A10

Which of the following is an example of a “smart” exercise choice? Wear extra layers of clothing Swim where a lifeguard can see Prepare large meals beforeha

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC