luvxmimi luvxmimi

23-04-2020
Biology

contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC

Respuesta :

Аноним Аноним

23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link

StephanyNo StephanyNo

23-04-2020

AUGGGUAAUGCGCCGUUCGCAUUAAUG

Answer Link

Otras preguntas

Solve the math problem

Do-yun has just joined a law firm as its purchasing agent for all supplies, equipment, and service contracts. In his previous position at another company, do-yu

Ravi drove 536 miles in 8 hours. At the same rate, how long would it take him to drive 871 miles?

I will give brainiest Can anyone give me the answers to 1-3 in the picture Find the slope of each line. Determine whether the lines are parallel perpendicular

2. Which budgetary category changed the most between your old budget and your new budget? Why? (5 points) The income changed the most by 340 3. How does your ne

What motif, or recurring idea, does Poe use to develop the story's theme? Cite examples from the text to explain how the same idea or event is repeated in the s

What is the five number summary for the data set? 1, 3, 4, 4, 5, 10, 12, 13, 14, 16, 19, 21, 23, 27, 30, 31, 31, 33, 44, 46, 51, 55, 58 A. 1, 11, 23, 38.5, 58 B

A person worked alongs the part of a rectangle from point p to point r. Find the distance travelled by the person and dint out the magnitude of the displacement

Air france collected cash on february 4 from the sale of a ticket to a customer on january 26. The flight took place on april 5. According to the revenue recogn

draw base ten blocks to show the number 200 in the place value chart below