XxAndreaXx09 XxAndreaXx09

25-06-2019
Mathematics

contestada

some body knows how to form a subset?

Respuesta :

65Aditya 65Aditya

25-06-2019

Answer:

Subset is part of set which is obtained from Universal set.

Step-by-step explanation:

Like for example :-

A - ( 1,2,3,4,5,6,7,8)

And B - ( 1,2 , 3)

So we can say B is subset of A.

Answer Link

Otras preguntas

Journalize the following business transactions in general journal form. Identify each transaction by number. You may omit explanations of the transactions. 1. T

Which of the following will lower blood pressure? Which of the following will lower blood pressure? angiotensin II atrial natriuretic peptide (ANP) aldosterone

Which type of formatting technique would you use to group information tomake it easier for the audience to understand?A. IllustrationsB. ItalicsC. Section headi

How would you illustrate and compare the business models for Airbnb, large hotel chains such as Marriott and Hilton, and bed & breakfast operators?

Jon refuses to wear his ball cap backwards or sideways because he does not want to be stereotyped as possessing the attitudinal and personality traits that he t

If an employer discovers that it has a job category where one might expect to find more women and minorities employed than are actually in its workforce, the em

How many years will it take you to accumulate $30,000 for a down payment on a house if you deposit $12,000 today and you expect to earn a 10% annual return on y

Robert Kelly wants to start a business in 10 years. He hopes to have $100,000 at that time to invest in the business. To reach his goal, he plans to invest a ce

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

Allyson is looking for jobs she can apply to after graduation. She is primarily searching for jobs closer to the "All Service" side of the product-service spect