rano1509 rano1509

22-03-2024
Business

contestada

The government pays the interest on a subsidized direct loan while you are in school.
a. true
b. false

Respuesta :

Otras preguntas

write a sentence using the words limiting factor and carrying capacity

A biological membrane is selectively permeable in that it can, to some extent,control which substances pass through it. Based ont he information provided in Boo

When a cell related to immunity activates only in reaction to a specific pathogen, it is called _____. (Points : 4) inducibility clonality lymphocytes T lymphoc

the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch

what type of sentence tends to express a strong emotion

Which of the following tactics do food manufacturers use to try to get you to buy their products? a. TV and radio commercials b. all of the above c. coupons d.

why were mountain men moving west

The SAT mathematics scores in the state of Florida are approximately normally distributed with a mean of 500 and a standard deviation of 100. Using the empiric

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Pedro tapes a 3 5/6 piece of paper to a 2 3/4 inch of piece with no overlap. how long is the piece of paper he made?